FASTA is a plaintext format for storing protein or nucleic acid (DNA or RNA) data as character sequences.  It is a popular interchange format for molecular biology software.

The commands Import and Export support this format.

The FASTA format employs the following standard IUB/IUPAC conventions for encoding protein or nucleic acid sequences as alphabetic characters.

In addition to codes specifying particular nucleic acids or amino acids, the convention supports codes for ambiguous sequences where a position may be occupied by more than one possible nucleic acid or amino acid. For example the code R matches either adenine (A) or guanine (G).

Content-Type: chemical/seq-aa-fasta, chemical/seq-na-fasta

$\mathrm{DNASequence}≔\mathrm{Import}\left(''example/humanmtDNA.fasta''\,\mathrm{base}=\mathrm{datadir}\right)\:$

$\mathrm{DNASequence}\left[1,1\right]$

$''Human\; mitochondrial\; genome,HVR2,CR,HVR1''$

$\mathrm{DNASequence}\left[1,2\right]\left[100..150\right]$

$''GGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATC''$

$\mathrm{frequencies}≔\mathrm{StringTools}:-\mathrm{CharacterFrequencies}\left(\mathrm{DNASequence}\left[1,2\right]\,\mathrm{dna}\right)$

$\mathrm{frequencies}≔''A''=5118,''C''=5185,''G''=2175,''T''=4092$

$\mathrm{Statistics}:-\mathrm{ColumnGraph}\left(\left[\mathrm{frequencies}\right]\right)$

IUPAC code for incomplete nucleic acid specification, National Center for Biotechnology Information.

A One-Letter Notation for Amino Acid Sequences, International Union of Pure and Applied Chemistry.